Stem-loop sequence osa-MIR166l

AccessionMI0001108 (change log)
DescriptionOryza sativa miR166l stem-loop
Gene family MIPF0000004; MIR166
Literature search

70 open access papers mention osa-MIR166l
(258 sentences)

Stem-loop
   -   a              uu         a     u   --   --     -aaa   uu 
5'  guu gguuaaggggauug  gucugguuc agguc cca  cau  ugugc    aug  c
    ||| ||||||||||||||  ||||||||| ||||| |||  |||  |||||    |||   
3'  cga ccaauuucccuaac  cggaccagg ucuag ggu  gua  acacg    uac  a
   a   -              uu         c     u   uc   gg     gagg   uu 
Get sequence
Deep sequencing
32030 reads, 2.15e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 16951817-16951933 [+]
intergenic
Database links

Mature sequence osa-miR166l-5p

Accession MIMAT0022871
Sequence

13 - 

ggauuguugucugguucaagg

 - 33

Get sequence
Deep sequencing39 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166l-3p

Accession MIMAT0001038
Previous IDsosa-miR166l
Sequence

87 - 

ucggaccaggcuucaaucccu

 - 107

Get sequence
Deep sequencing31989 reads, 2 experiments
Evidence by similarity; MI0000204
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).