Stem-loop sequence osa-MIR164e

AccessionMI0001105 (change log)
DescriptionOryza sativa miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

69 open access papers mention osa-MIR164e
(312 sentences)

Stem-loop
   uu    ag          ca                     guguagcuucgcugcgcguccaug 
5'   gugc  gguggagaag  gggcacgugagcggccaucca                        g
     ||||  ||||||||||  |||||||||||||||||||||                         
3'   cacg  ccaccucuuc  ccuguguacuugcugguaggu                        c
   gu    ag          ug                     uugaggucuagugcgcgcaagcgg 
Get sequence
Deep sequencing
3039 reads, 1.9e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR164 family [1]. It is predicted to target mRNAs coding for NAC domain transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 10542157-10542288 [+]
intergenic
Database links

Mature sequence osa-miR164e

Accession MIMAT0001035
Sequence

11 - 

uggagaagcagggcacgugag

 - 31

Get sequence
Deep sequencing3016 reads, 2 experiments
Evidence by similarity; MI0000197
Database links

References

1