Stem-loop sequence osa-MIR164c

AccessionMI0001103 (change log)
DescriptionOryza sativa miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

67 open access papers mention osa-MIR164c
(280 sentences)

Stem-loop
   -     cu  u        ca           aaaugca    --     g  -     aau 
5'  agguu  ug uggagaag  ggguacgugca       cacc  gguug uc gagcu   u
    |||||  || ||||||||  |||||||||||       ||||  ||||| || |||||    
3'  uccgg  ac accucuuc  cucgugcacgu       gugg  ccagc ag cucga   a
   u     -u  c        cc           -aagcua    ua     -  u     aca 
Get sequence
Deep sequencing
2821 reads, 1.9e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR164 family [1]. It is predicted to target mRNAs coding for NAC domain transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 17327440-17327558 [+]
intergenic
Database links

Mature sequence osa-miR164c

Accession MIMAT0001033
Sequence

11 - 

uggagaagcaggguacgugca

 - 31

Get sequence
Deep sequencing2821 reads, 2 experiments
Evidence by similarity; MI0000197
Database links

References

1