Stem-loop sequence osa-MIR162b

AccessionMI0001102 (change log)
DescriptionOryza sativa miR162b stem-loop
Gene family MIPF0000169; MIR162_2
Literature search

26 open access papers mention osa-MIR162b
(42 sentences)

Stem-loop
   u      ugc    gc    u            uc    c   c     -cugc  --c     au  c 
5'  ggguga   cugg  gcag gguuuaucgauc  uucc ugc uugug     uc   gaucg  gc c
    ||||||   ||||  |||| ||||||||||||  |||| ||| |||||     ||   |||||  ||  
3'  uucacu   gacc  cguc ccgaauagcuag  aagg acg aacau     ag   uuagu  cg g
   u      cua    ua    u            cu    -   c     auaau  uuc     --  u 
Get sequence
Deep sequencing
597 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR162 family [1]. It is predicted to target mRNAs coding for DICER-LIKE 1 (DL1) proteins.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 24405899-24406032 [+]
intergenic
Database links

Mature sequence osa-miR162b

Accession MIMAT0001032
Sequence

104 - 

ucgauaagccucugcauccag

 - 124

Get sequence
Deep sequencing594 reads, 2 experiments
Evidence by similarity; MI0000195
Database links

References

1