Stem-loop sequence osa-MIR160f

AccessionMI0001101 (change log)
DescriptionOryza sativa miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

60 open access papers mention osa-MIR160f
(189 sentences)

Stem-loop
   -  auu   g    c         g       u   a      u    - u 
5'  gg   aac cugc uggcucccu aaugcca ccg gaagcg gccg c g
    ||   ||| |||| ||||||||| ||||||| ||| |||||| |||| |  
3'  uc   uug gacg acugaggga uuacggu ggu cuucgu cggc g u
   c  -gu   g    u         g       u   c      -    c g 
Get sequence
Deep sequencing
506 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR160 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 24396882-24396981 [+]
intergenic
Database links

Mature sequence osa-miR160f-5p

Accession MIMAT0001031
Previous IDsosa-miR160f
Sequence

11 - 

ugccuggcucccugaaugcca

 - 31

Get sequence
Deep sequencing491 reads, 2 experiments
Evidence by similarity; MI0000190
Database links

Mature sequence osa-miR160f-3p

Accession MIMAT0022868
Sequence

72 - 

gcauugagggagucaugcagg

 - 92

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).