Stem-loop sequence osa-MIR160e

AccessionMI0001100 (change log)
DescriptionOryza sativa miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

59 open access papers mention osa-MIR160e
(190 sentences)

Stem-loop
   gua    a     c    u  c         cu    ug  u      cc     acu 
5'    gggg uaugc uggc cc uguaugccg  cgca  gc gccaac  aauga   c
      |||| ||||| |||| || |||||||||  ||||  || ||||||  |||||    
3'    uccc guacg accg gg gcgugcggc  gcgu  cg cgguug  uugcu   g
   uuc    g     a    u  a         au    --  c      --     cua 
Get sequence
Deep sequencing
530 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR160 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 2216761-2216874 [-]
intergenic
Database links

Mature sequence osa-miR160e-5p

Accession MIMAT0001030
Previous IDsosa-miR160e
Sequence

11 - 

ugccuggcucccuguaugccg

 - 31

Get sequence
Deep sequencing519 reads, 2 experiments
Evidence by similarity; MI0000190
Database links

Mature sequence osa-miR160e-3p

Accession MIMAT0022867
Sequence

86 - 

gcgugcgaggugccaagcaug

 - 106

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).