Stem-loop sequence osa-MIR319b

AccessionMI0001099 (change log)
DescriptionOryza sativa miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

51 open access papers mention osa-MIR319b
(256 sentences)

Stem-loop
   --  u   u   a a    gu           cu  u         ua      -   --  g  g   ac        c  ca   c    aagaaa    ug 
5'   ga gga gga g gagc  ccuucagucca  ca gggcggugc  gggucg aau  ua cu ccg  ucauucac ca  ugc aagc      cgcu  a
     || ||| ||| | ||||  |||||||||||  || |||||||||  |||||| |||  || || |||  |||||||| ||  ||| ||||      ||||   
3'   cu ccu ccu c cucg  ggaagucaggu  gu ucugccgcg  ucuagc uug  au ga ggc  aguaagug gu  acg uucg      gcga  g
   ag  -   -   c -    ug           uc  u         -c      c   ca  g  g   ga        a  ag   a    ----aa    ua 
Get sequence
Deep sequencing
359 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 6677570-6677766 [-]
intergenic
Database links

Mature sequence osa-miR319b

Accession MIMAT0001029
Sequence

168 - 

uuggacugaagggugcuccc

 - 187

Get sequence
Deep sequencing112 reads, 2 experiments
Evidence by similarity; MI0000544
Database links

References

1