Stem-loop sequence osa-MIR159f

AccessionMI0001097 (change log)
DescriptionOryza sativa miR159f stem-loop
Gene family MIPF0000010; MIR159
Literature search

76 open access papers mention osa-MIR159f
(349 sentences)

Stem-loop
   gaagaagaagac                  uc  g         ----    a  aug  g  g    u     g u    c    -     u  c 
5'             gagcucccuucgauccaa  ca gagaggaag    uggu gg   ca cu ccgg ucaug a accu ugca gugca gu g
               ||||||||||||||||||  || |||||||||    |||| ||   || || |||| ||||| | |||| |||| ||||| || u
3'             cucgagggaaguuagguu  gu uucuccuuc    acca cc   gu ga ggcc aguac u uggg acgu cacgu cg a
   cucucuccacau                  -c  a         uguu    c  -aa  a  g    c     g u    u    u     u  g 
Get sequence
Deep sequencing
1807 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 6693112-6693299 [+]
intergenic
Database links

Mature sequence osa-miR159f

Accession MIMAT0001027
Sequence

158 - 

cuuggauugaagggagcucua

 - 178

Get sequence
Deep sequencing1781 reads, 2 experiments
Evidence by similarity; MI0000544
Database links

References

1