Stem-loop sequence osa-MIR159e

AccessionMI0001096 (change log)
DescriptionOryza sativa miR159e stem-loop
Gene family MIPF0000010; MIR159
Literature search

76 open access papers mention osa-MIR159e
(344 sentences)

Stem-loop
   g   a  -a   a          u         u   g        ----   ua  aug  g  g   gu     g u    c    - u c     a 
5'  aug ag  aga gagcucccuu cgauccaau cag agaggaag    ugg  gg   ca cu ccg  ucaug a accu ugga g g agggc a
    ||| ||  ||| |||||||||| ||||||||| ||| ||||||||    |||  ||   || || |||  ||||| | |||| |||| | | ||||| a
3'  uac uc  ucu cucgagggaa guuagguua guu ucuccuuc    acc  cc   gu ga ggc  aguac u uggg acuu c c uccug u
   -   a  ga   c          -         -   a        uguu   gc  -aa  a  g   uc     g u    u    u c a     a 
Get sequence
Deep sequencing
1777 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 9760708-9760898 [-]
intergenic
Database links

Mature sequence osa-miR159e

Accession MIMAT0001026
Sequence

161 - 

auuggauugaagggagcuccu

 - 181

Get sequence
Deep sequencing1756 reads, 2 experiments
Evidence by similarity; MI0000544
Database links

References

1