Stem-loop sequence osa-MIR159d

AccessionMI0001095 (change log)
DescriptionOryza sativa miR159d stem-loop
Gene family MIPF0000010; MIR159
Literature search

76 open access papers mention osa-MIR159d
(330 sentences)

Stem-loop
   ugau   -  ga                    u   g       ----    ug  aug  g  g    u     g u    c    -  u  u   g 
5'     gug ag  ggagcuccuuucgauccaau cag agaggaa    gugg  gg   ca cu ccgg ucaug a accu ugca gu ca gcc g
       ||| ||  |||||||||||||||||||| ||| |||||||    ||||  ||   || || |||| ||||| | |||| |||| || || |||  
3'     cac uc  ccucgagggaaguuagguua guu ucuccuu    uacc  cc   gu ga gguc aguac u uggg acgu ca gu cgg u
   -auc   a  gg                    -   a       gugu    gu  -aa  a  g    c     g u    u    u  c  c   a 
Get sequence
Deep sequencing
1818 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 6563756-6563944 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR159d
osa-MIR159dChr1: 6563756-6563944 [-]
osa-MIR159cChr1: 6556048-6556244 [-]
Database links

Mature sequence osa-miR159d

Accession MIMAT0001025
Sequence

159 - 

auuggauugaagggagcuccg

 - 179

Get sequence
Deep sequencing1775 reads, 2 experiments
Evidence by similarity; MI0000189
Database links

References

1