Stem-loop sequence osa-MIR159b

AccessionMI0001093 (change log)
DescriptionOryza sativa miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

77 open access papers mention osa-MIR159b
(356 sentences)

Stem-loop
        u  a ug            u     u  aa    uaucug    -  -   a a   g    u     guuc    uau        aua 
5' gguua ga g  gagcuccuuucg uccaa ga  gguu      aagg gu gau c gcu cuug ucaug    ccac   ucuaucuc   g
   ||||| || |  |||||||||||| ||||| ||  ||||      |||| || ||| | ||| |||| |||||    ||||   ||||||||   g
3' cuagu cu c  cucgagggaagu agguu cu  ccag      uucc ca cua g cga gaac aguac    ggug   ggauagag   a
        u  a gu            u     u  ca    ---ucg    u  a   a c   g    c     guuu    uuc        aaa 
Get sequence
Deep sequencing
2511 reads, 1.2e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 1215030-1215217 [+]
intergenic
Database links

Mature sequence osa-miR159b

Accession MIMAT0001023
Sequence

158 - 

uuuggauugaagggagcucug

 - 178

Get sequence
Deep sequencing2239 reads, 2 experiments
Evidence by similarity; MI0000189
Database links

References

1