Stem-loop sequence osa-MIR159a

AccessionMI0001092 (change log)
DescriptionOryza sativa miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

84 open access papers mention osa-MIR159a
(503 sentences)

Stem-loop
   guugu   c  u                  aa     u   gc   -    c   ug    g     u    g uc    u      cu   uguucaucauucagcucgagaucugaaagaaacuacuccaauuua 
5'      gga gu gagcuccuuucgguccaa  agggg guu  ugu gggu gau  agcu cuggg caug a  ccgu agccua  cca                                             u
        ||| || ||||||||||||||||||  ||||| |||  ||| |||| |||  |||| ||||| |||| |  |||| ||||||  |||                                              
3'      ucu cg cucgagggaaguuagguu  ucucc cag  aca ccca cua  ucga gaccc guac u  ggua ucggau  ggu                                             a
   uguuu   a  u                  --     -   gu   u    a   cg    g     c    g uc    u      ag   uguugcucaugagguaguaaaaggauagauguguguaugauaauc 
Get sequence
Deep sequencing
3041 reads, 1.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 17681923-17682194 [+]
intergenic
Database links

Mature sequence osa-miR159a.2

Accession MIMAT0009200
Sequence

201 - 

uugcaugccccaggagcugca

 - 221

Get sequence
Deep sequencing687 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence osa-miR159a.1

Accession MIMAT0001022
Previous IDsosa-miR159a
Sequence

242 - 

uuuggauugaagggagcucug

 - 262

Get sequence
Deep sequencing2239 reads, 2 experiments
Evidence by similarity; MI0000218
Database links

References

1
2
PMID:19055717 "Identification of precursor transcripts for 6 novel miRNAs expands the diversity on the genomic organisation and expression of miRNA genes in rice" Lacombe S, Nagasaki H, Santi C, Duval D, Piegu B, Bangratz M, Breitler JC, Guiderdoni E, Brugidou C, Hirsch J, Cao X, Brice C, Panaud O, Karlowski WM, Sato Y, Echeverria M BMC Plant Biol. 8:123(2008).