Stem-loop sequence osa-MIR156l

AccessionMI0001091
DescriptionOryza sativa miR156l stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gcuaggga  c       -    -               ucu   cuu       u g  -----------           gac 
5'         gc gacagaa gaga gugagcauauauagu   uuc   gcauaug g uc           auauguguguu   u
           || ||||||| |||| |||||||||||||||   |||   ||||||| | ||           |||||||||||   g
3'         cg cugucuu cucu cacucguguauaucg   aag   cguguac u ag           uauauacauag   a
   cuauuaaa  a       u    u               ---   -uu       u g  agagagagaua           aga 
Get sequence
Deep sequencing
14234990 reads, 1.59e+05 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 5230609-5230764 [+]
intergenic

Mature sequence osa-miR156l-5p

Accession MIMAT0001021
Previous IDsosa-miR156l
Sequence

11 - 

cgacagaagagagugagcaua

 - 31

Get sequence
Deep sequencing143924 reads, 61 experiments
Evidence by similarity; MI0000178

Mature sequence osa-miR156l-3p

Accession MIMAT0022866
Sequence

127 - 

gcucacuucucuuucugucagc

 - 148

Get sequence
Deep sequencing339 reads, 40 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).