Stem-loop sequence osa-MIR156k

AccessionMI0001090 (change log)
DescriptionOryza sativa miR156k stem-loop
Gene family MIPF0000008; MIR156
Literature search

122 open access papers mention osa-MIR156k
(656 sentences)

Stem-loop
   uu  ga ug        -   -g          --a   -     c      ga 
5'   ga  g  augacaga aga  agagagcaca   ccc ggcag agcgac  c
     ||  |  |||||||| |||  ||||||||||   ||| ||||| ||||||  g
3'   cu  c  uacugucu ucu  ucucucgugu   ggg ccguc ucgcug  g
   ac  gc gu        a   ag          gcc   a     u      gc 
Get sequence
Deep sequencing
378295 reads, 2.61e+05 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 18289107-18289212 [-]
intergenic
Database links

Mature sequence osa-miR156k

Accession MIMAT0001020
Sequence

11 - 

ugacagaagagagagagcaca

 - 31

Get sequence
Deep sequencing378295 reads, 2 experiments
Evidence by similarity; MI0000178
Database links

References

1