Stem-loop sequence ath-MIR167c

AccessionMI0001088 (change log)
DescriptionArabidopsis thaliana miR167c stem-loop
Gene family MIPF0000125; MIR167_2
Literature search

45 open access papers mention ath-MIR167c
(232 sentences)

Stem-loop
   c  g      -uu                  u    uc       ---     ----       uaguuaauaaauauuuuau 
5'  ca uagcag   aagcugccagcaugaucu gucu  cucucuu   agguu    ucauaua                   a
    || ||||||   |||||||||||||||||| ||||  |||||||   |||||    |||||||                   u
3'  gu aucguc   uuugauggucguacugga caga  gagagag   uucga    aguauau                   a
   -  a      cac                  u    ga       aga     uacu       uagaacauucuuguucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1], subsequently verified in [2]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 1306622-1306781 [-]
intergenic
Database links

Mature sequence ath-miR167c-5p

Accession MIMAT0001018
Previous IDsath-miR167c
Sequence

12 - 

uaagcugccagcaugaucuug

 - 32

Get sequence
Evidence experimental; 454 [2], Illumina [3]

Mature sequence ath-miR167c-3p

Accession MIMAT0031917
Sequence

130 - 

uaggucaugcugguaguuucacc

 - 152

Get sequence
Evidence not experimental

References

1
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).