Stem-loop sequence ath-MIR319c

AccessionMI0001086 (change log)
DescriptionArabidopsis thaliana miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

34 open access papers mention ath-MIR319c
(256 sentences)

Stem-loop
       uau        a              u        gaaa      a gg           g   ac    c  uc  aa    c     ag   aac 
5' uaga   agaaggag uucuuucaguccag cauggaua    aagaag g  uagaaauaucu ccg  ucau ca  ca  cacu guggu  aga   g
   ||||   |||||||| |||||||||||||| ||||||||    |||||| |  ||||||||||| |||  |||| ||  ||  |||| |||||  |||   a
3' aucu   ucuuccuc agggaagucagguu gugucuau    uucuuc c  guuuuuauaga ggc  agua gu  gu  guga cgcca  uuu   u
       uuu        g              u        ----      - ua           g   gu    a  gu  ca    -     aa   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1], subsequently verified in [2,3]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 17029701-17029899 [+]
intergenic
Database links

Mature sequence ath-miR319c

Accession MIMAT0001016
Sequence

170 - 

uuggacugaagggagcuccuu

 - 190

Get sequence
Evidence experimental; cloned [2], Northern [2], 454 [3]

References

1
2
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).