Stem-loop sequence ath-MIR159c

AccessionMI0001085 (change log)
DescriptionArabidopsis thaliana miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

49 open access papers mention ath-MIR159c
(451 sentences)

Stem-loop
   guguaac                -c      a         ---caa   ---uu      cuaaaau c            u  a   cu     a     a    gcggug    a 
5'        agaaggagcucccuuc  uccaaa cgaagagga      gau     gaggaa       g agaaucuaagag uc ugu  uccuc uagag gugc      uuaa a
          ||||||||||||||||  |||||| |||||||||      |||     ||||||       | |||||||||||| || |||  ||||| ||||| ||||      ||||  
3'        uuuuccucgagggaag  agguuu gcuucucuu      cua     cucuuu       c ucuuagauucuc ag acg  agggg auuuc cacg      aguu g
   cuucuuc                uu      -         cucuua   uacau      ---cucc -            c  c   uu     a     a    -aaaga    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 18994632-18994856 [+]
intergenic
Database links

Mature sequence ath-miR159c

Accession MIMAT0001015
Sequence

195 - 

uuuggauugaagggagcuccu

 - 215

Get sequence
Evidence experimental; 454 [2]

References

1
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).