Stem-loop sequence ath-MIR158b

AccessionMI0001084 (change log)
DescriptionArabidopsis thaliana miR158b stem-loop
Gene family MIPF0000294; MIR158
Literature search

12 open access papers mention ath-MIR158b
(29 sentences)

Stem-loop
      u u   cuu           cu     -a     ug   a 
5' auc c gug   cuuugucuaca  uuugg  aaagg  aug u
   ||| | |||   |||||||||||  |||||  |||||  |||  
3' uag g cau   gaaacagaugu  aaacc  uuuuc  uac a
      u c   aac           --     cc     gu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 20772218-20772302 [+]
intergenic
Database links

Mature sequence ath-miR158b

Accession MIMAT0001014
Sequence

56 - 

ccccaaauguagacaaagca

 - 75

Get sequence
Evidence experimental; 454 [2], Illumina [3]

References

1
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).