Stem-loop sequence ath-MIR156g

AccessionMI0001082
DescriptionArabidopsis thaliana miR156g stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   auaacga   c    -               a  u    cuuu   u     g 
5'        agg gaca gaagagagugagcac ca ggcu    uuc agcau c
          ||| |||| ||||||||||||||| || ||||    ||| |||||  
3'        ucc cugu cuucucucauucgug gu ucga    aag ucgua u
   ucucucg   u    u               c  c    ----   c     c 
Get sequence
Deep sequencing
10478 reads, 2.08e+04 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1], subsequently verified in [2]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr2: 8412516-8412618 [-]
intergenic
Database links

Mature sequence ath-miR156g

Accession MIMAT0001012
Sequence

11 - 

cgacagaagagagugagcac

 - 30

Get sequence
Deep sequencing759 reads, 6 experiments
Evidence experimental; 454 [2], Illumina [3]

References

1
2
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
3
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).