Stem-loop sequence ath-MIR408

AccessionMI0001080 (change log)
DescriptionArabidopsis thaliana miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

24 open access papers mention ath-MIR408
(70 sentences)

Stem-loop
   aag     auu    uu         --gaagac     --g u     ---        --------------------------       caa    a      auu   uuuac       uuaa 
5'    guuag   ggua  gcaaugaaa        aaagc   g aauga   gagagaga                          cagggaa   gcag gcaugg   gag     uaaaaca    a
      |||||   ||||  |||||||||        |||||   | |||||   ||||||||                          |||||||   |||| ||||||   |||     |||||||    c
3'    caauc   ucau  cguuauuuu        uuucg   c uuacu   cucucucu                          gucccuu   cguc cguacc   cuc     guuuugu    g
   --g     --g    --         aagguaac     aca u     uuc        cuuuauaucucuuuuuuucucccucg       cuc    a      cau   ----u       cuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 19319814-19320031 [+]
intergenic
Database links

Mature sequence ath-miR408-5p

Accession MIMAT0031915
Sequence

53 - 

acagggaacaagcagagcaug

 - 73

Get sequence
Evidence experimental; Illumina [5]

Mature sequence ath-miR408-3p

Accession MIMAT0001011
Previous IDsath-miR408
Sequence

120 - 

augcacugccucuucccuggc

 - 140

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2-3], MPSS [2], Illumina [4]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
5
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).