Stem-loop sequence ath-MIR404

AccessionMI0001073 (change log)
DescriptionArabidopsis thaliana miR404 stem-loop
Stem-loop
   uagca  -uu  uuu  uuaac   g                           gug       a  cu  -c    g 
5'      ug   cg   ca     gcu gcgguugcggcagcggcugcgguagcg   gcggcaa ca  ac  gcag u
        ||   ||   ||     ||| |||||||||||||||||||||||||||   ||||||| ||  ||  ||||  
3'      gc   gc   gu     ugg cgccaacgccgucgccgacgccgucgc   cgccguu gu  ug  uguu u
   --gca  uuu  -uu  uucuu   a                           aga       -  uu  cu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 11230463-11230612 [-]
intergenic
Database links

Mature sequence ath-miR404

Accession MIMAT0001005
Sequence

16 - 

auuaacgcuggcgguugcggcagc

 - 39

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).