Stem-loop sequence ath-MIR403

AccessionMI0001072 (change log)
DescriptionArabidopsis thaliana miR403 stem-loop
Gene family MIPF0000290; MIR403
Literature search

7 open access papers mention ath-MIR403
(9 sentences)

Stem-loop
   uugucauuaga    u  u     au    u    u                ggcuuuauguaagagauucu 
5'            agag cg auuac  guuu gugc ugaaucuaauucaaca                    u
              |||| || |||||  |||| |||| ||||||||||||||||                    u
3'            uuuc gu uaaug  caaa cacg acuuagauuagguugu                    a
   -----------    u  c     cu    -    c                uguuucuaauauccuuaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr2: 19415052-19415186 [+]
intergenic
Database links

Mature sequence ath-miR403-5p

Accession MIMAT0031914
Sequence

26 - 

uguuuugugcuugaaucuaauu

 - 47

Get sequence
Evidence not experimental

Mature sequence ath-miR403-3p

Accession MIMAT0001004
Previous IDsath-miR403
Sequence

103 - 

uuagauucacgcacaaacucg

 - 123

Get sequence
Evidence experimental; cloned [1-2], Northern [1], 3'RACE [2], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).