Stem-loop sequence ath-MIR402

AccessionMI0001071 (change log)
DescriptionArabidopsis thaliana miR402 stem-loop
Gene family MIPF0001123; MIR402
Literature search

5 open access papers mention ath-MIR402
(6 sentences)

Stem-loop
   cguggua     -    -g   u            u   ccuuu     uuaacccauauuuuc           c    u           acaucu   -       --a    gucauuuuucugaaaucuucuugccucaauuuccaacagcagauucaucuu 
5'        gauaa guuu  agu gcauaguggcag cuu     guuug               augauucgagg cuau aaaccucuguu      gcu uuuugaa   aguu                                                   u
          ||||| ||||  ||| |||||||||||| |||     |||||               ||||||||||| |||| |||||||||||      ||| |||||||   ||||                                                   c
3'        cuauu caaa  uca cguaucaucguc gag     caaac               uacuaagcucc gaua uuuggggauaa      cga aaagcuu   ucag                                                   a
   ----aaa     u    ag   u            u   -----     -------------ua           a    -           aauuuc   u       cag    aauuaaagaaggguggaguaaaaaagauaguuuuugauugccuaguagguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 29016520-29016828 [+]
intergenic
Database links

Mature sequence ath-miR402

Accession MIMAT0001003
Sequence

67 - 

uucgaggccuauuaaaccucug

 - 88

Get sequence
Evidence experimental; cloned [1], Northern [1], MPSS [2], 454 [3]

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).