Stem-loop sequence ath-MIR400

Accession MI0001069
Description Arabidopsis thaliana miR400 stem-loop
Gene family MIPF0001157; MIR400
Stem-loop 
--u    a ug         g              a a    gu      a 
   gagg u  uuuaugaga uauuauaagucacu c uuug  aagcaa g
   |||| |  ||||||||| |||||||||||||| | ||||  ||||||  
   uuuu g  aaguacucu auaguauucaguga g aaac  uuuguu u
acg    a gu         a              a c    uc      g
Get sequence
Deep sequencing
192 reads, 8 experiments
Genome context
Coordinates (TAIR10) Overlapping transcripts
chr1: 11785936-11786037 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR400
ath-MIR400 chr1: 11785936-11786037 [+]
ath-MIR5654 chr1: 11786292-11786371 [+]

Mature sequence ath-miR400

Accession MIMAT0001001
Sequence

12 -  

uaugagaguauuauaagucac

 - 32

Get sequence
Deep sequencing 183 reads, 7 experiments
Evidence experimental; cloned [1], Northern [1], 454 [2-3], MPSS [2], Solexa [4]
Validated targets

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).