Stem-loop sequence ebv-mir-BART2

AccessionMI0001068
DescriptionEpstein Barr virus miR-BART2 stem-loop
Stem-loop
ac        g  -u    -       uguc 
  uauuuucu ca  ucgc ccuugcg    c
  |||||||| ||  |||| |||||||     
  auaaaaga gu  agcg ggaacgu    a
aa        g  uu    a       uguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature miRNA names reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 152745-152806 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART2
ebv-mir-BART21HHV507799: 145503-145578 [+]
ebv-mir-BART18HHV507799: 145932-146050 [+]
ebv-mir-BART7HHV507799: 146425-146510 [+]
ebv-mir-BART8HHV507799: 146759-146840 [+]
ebv-mir-BART9HHV507799: 146946-147032 [+]
ebv-mir-BART22HHV507799: 147161-147231 [+]
ebv-mir-BART10HHV507799: 147304-147393 [+]
ebv-mir-BART11HHV507799: 147524-147609 [+]
ebv-mir-BART12HHV507799: 147888-147970 [+]
ebv-mir-BART19HHV507799: 148198-148290 [+]
ebv-mir-BART20HHV507799: 148319-148417 [+]
ebv-mir-BART13HHV507799: 148512-148597 [+]
ebv-mir-BART14HHV507799: 148731-148815 [+]
ebv-mir-BART2HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART2-5p

Accession MIMAT0001000
Previous IDsebv-miR-BART2
Sequence

3 - 

uauuuucugcauucgcccuugc

 - 24

Get sequence
Evidence experimental; cloned [1-2], Northern [1]
Validated targets

Mature sequence ebv-miR-BART2-3p

Accession MIMAT0004744
Sequence

39 - 

aaggagcgauuuggagaaaauaaa

 - 62

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).