Stem-loop sequence ebv-mir-BART2

Accession MI0001068
Description Epstein Barr virus miR-BART2 stem-loop
Stem-loop
   ac        g  -u    -       uguc 
5'   uauuuucu ca  ucgc ccuugcg    c
     |||||||| ||  |||| |||||||     
3'   auaaaaga gu  agcg ggaacgu    a
   aa        g  uu    a       uguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature miRNA names reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 152745-152806 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART2
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]
ebv-mir-BART2 HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART2-5p

Accession MIMAT0001000
Previous IDs ebv-miR-BART2
Sequence

3 - 

uauuuucugcauucgcccuugc

 - 24

Get sequence
Evidence experimental; cloned [1-2], Northern [1]
Validated targets

Mature sequence ebv-miR-BART2-3p

Accession MIMAT0004744
Sequence

39 - 

aaggagcgauuuggagaaaauaaa

 - 62

Get sequence
Evidence experimental; cloned [2]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).