Stem-loop sequence ebv-mir-BHRF1-3

AccessionMI0001066 (change log)
DescriptionEpstein Barr virus miR-BHRF1-3 stem-loop
Stem-loop
   --uc      ga      u      aca   aau 
5'     uaacgg  agugug aagcac   cgu   u
       ||||||  |||||| ||||||   |||   u
3'     auugcu  ucgcac uucgug   gcg   g
   uaaa      uc      -      ---   aac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 42966-43030 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BHRF1-3
ebv-mir-BHRF1-1HHV507799: 41471-41536 [+]
ebv-mir-BHRF1-2HHV507799: 42848-42912 [+]
ebv-mir-BHRF1-3HHV507799: 42966-43030 [+]
Database links

Mature sequence ebv-miR-BHRF1-3

Accession MIMAT0000998
Sequence

3 - 

uaacgggaaguguguaagcaca

 - 24

Get sequence
Evidence experimental; cloned [1-2], Northern [1]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).