Stem-loop sequence ebv-mir-BHRF1-2

AccessionMI0001065 (change log)
DescriptionEpstein Barr virus miR-BHRF1-2 stem-loop
Gene family MIPF0000332; mir-BHRF1-2
Stem-loop
          a           c       ugau 
5' cuuuuaa uucuguugcag agauagc    a
   ||||||| ||||||||||| |||||||    c
3' gaaaguu aagacggcguu ucuauug    c
          a           u       uaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 42848-42912 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BHRF1-2
ebv-mir-BHRF1-1HHV507799: 41471-41536 [+]
ebv-mir-BHRF1-2HHV507799: 42848-42912 [+]
ebv-mir-BHRF1-3HHV507799: 42966-43030 [+]
Database links

Mature sequence ebv-miR-BHRF1-2-5p

Accession MIMAT0000996
Previous IDsebv-miR-BHRF1-2*
Sequence

6 - 

aaauucuguugcagcagauagc

 - 27

Get sequence
Evidence experimental; cloned [1-2], Northern [1]

Mature sequence ebv-miR-BHRF1-2-3p

Accession MIMAT0000997
Previous IDsebv-miR-BHRF1-2
Sequence

41 - 

uaucuuuugcggcagaaauuga

 - 62

Get sequence
Evidence experimental; cloned [1-2], Northern [1]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).