Stem-loop sequence ebv-mir-BHRF1-1

AccessionMI0001064 (change log)
DescriptionEpstein Barr virus miR-BHRF1-1 stem-loop
Gene family MIPF0000331; mir-BHRF1-1
Stem-loop
   -ua       ga    c     a    cc  uu 
5'    uuaaccu  ucag cccgg guug  ug  u
      |||||||  |||| ||||| ||||  ||   
3'    aguugga  aguc gggcc caau  ac  c
   aac       ga    c     c    -c  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 41471-41536 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BHRF1-1
ebv-mir-BHRF1-1HHV507799: 41471-41536 [+]
ebv-mir-BHRF1-2HHV507799: 42848-42912 [+]
ebv-mir-BHRF1-3HHV507799: 42966-43030 [+]
Database links

Mature sequence ebv-miR-BHRF1-1

Accession MIMAT0000995
Sequence

4 - 

uaaccugaucagccccggaguu

 - 25

Get sequence
Evidence experimental; cloned [1-2], Northern [1]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).