Stem-loop sequence ebv-mir-BHRF1-1

AccessionMI0001064 (change log)
DescriptionEpstein Barr virus miR-BHRF1-1 stem-loop
Gene family MIPF0000331; mir-BHRF1-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-BHRF1-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-BHRF1-1 microRNA precursor found in Human herpesvirus 4 (Epstein-Barr virus) and Cercopithicine herpesvirus 15. In Epstein-Barr virus, mir-BHRF1-1 is found in the 5' UTR of the BHRF1 (Bam HI fragment H rightward open reading frame 1) gene, which is known to encode a distant Bcl-2 homolog. The mature sequence is excised from the 5' arm of the hairpin. Two other miRNA precursors were found in this reading frame, namely Mir-BHRF1-2 and Mir-BHRF1-3. BHRF-1-1 miRNA is though to operate as part of a 'miRNA cluster' with two other microRNAs also found in the Epstein-Barr virus genome. BHRF-1-1 has been shown to be expressed in latency-III infected lymphoblasts.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -ua       ga    c     a    cc  uu 
5'    uuaaccu  ucag cccgg guug  ug  u
      |||||||  |||| ||||| ||||  ||   
3'    aguugga  aguc gggcc caau  ac  c
   aac       ga    c     c    -c  ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 41471-41536 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BHRF1-1
ebv-mir-BHRF1-1HHV507799: 41471-41536 [+]
ebv-mir-BHRF1-2HHV507799: 42848-42912 [+]
ebv-mir-BHRF1-3HHV507799: 42966-43030 [+]
Database links

Mature sequence ebv-miR-BHRF1-1

Accession MIMAT0000995
Sequence

4 - 

uaaccugaucagccccggaguu

 - 25

Get sequence
Evidence experimental; cloned [1-2], Northern [1]

References

1
PMID:15118162 "Identification of virus-encoded microRNAs" Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T Science. 304:734-736(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).