Stem-loop sequence osa-MIR399k

AccessionMI0001063 (change log)
DescriptionOryza sativa miR399k stem-loop
Gene family MIPF0000015; MIR399
Literature search

58 open access papers mention osa-MIR399k
(222 sentences)

Stem-loop
     c  c   g u         g           auguugcaguucaucaucg 
5' ag ug auu c gggcaaguu uccuuuggcag                   a
   || || ||| | ||||||||| |||||||||||                   u
3' uc ac uaa g cccguuuaa aggaaaccguc                   g
     u  u   g c         -           aucagaccauugggggucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 26311253-26311358 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR399k
osa-MIR399cChr5: 26305938-26306047 [-]
osa-MIR399hChr5: 26307936-26308034 [+]
osa-MIR399kChr5: 26311253-26311358 [+]
Database links

Mature sequence osa-miR399k

Accession MIMAT0000994
Sequence

76 - 

ugccaaaggaaauuugccccg

 - 96

Get sequence
Evidence by similarity; MI0001023

References

1