Stem-loop sequence osa-MIR399k

Accession

MI0001063

Description

Oryza sativa miR399k stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

  c  c   g u         g           auguugcaguucaucaucg 
ag ug auu c gggcaaguu uccuuuggcag                   a
|| || ||| | ||||||||| |||||||||||                   u
uc ac uaa g cccguuuaa aggaaaccguc                   g
  u  u   g c         -           aucagaccauugggggucc 

Deep sequencing

2 reads, 1 experiments

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr5: 26311253-26311358 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR399k

• osa-MIR399c: Chr5: 26305938-26306047 [-]
• osa-MIR399h: Chr5: 26307936-26308034 [+]
• osa-MIR399k: Chr5: 26311253-26311358 [+]

Mature sequence osa-miR399k

• Accession: MIMAT0000994
• Sequence: 76 - ugccaaaggaaauuugccccg - 96
• Deep sequencing: 2 reads, 1 experiments
• Evidence: by similarity; MI0001023

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).