|
miRBase |
|
Stem-loop sequence osa-MIR399j |
|||||
| Accession | MI0001062 | ||||
| Description | Oryza sativa miR399j stem-loop | ||||
| Gene family | MIPF0000015; MIR399 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence. |
||||
| Stem-loop |
c uc uc a ---au --- cuu aguccaguuu agggc cucuc uuggcaggg gc guga agu u |||||||||| ||||| ||||| ||||||||| || |||| ||| ucaggucaaa ucccg gagag aaccgucuc cg uacu ucg u a uu ga c acuuu cac aug |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1]. |
||||
| Genome context |
|
||||
Mature sequence osa-miR399j |
|
| Accession | MIMAT0000993 |
| Sequence |
76 - ugccaaaggagaguugcccua - 96 |
| Deep sequencing | 147 reads, 4 experiments |
| Evidence | by similarity; MI0001020 |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|