Stem-loop sequence osa-MIR399j

AccessionMI0001062 (change log)
DescriptionOryza sativa miR399j stem-loop
Gene family MIPF0000015; MIR399
Literature search

61 open access papers mention osa-MIR399j
(229 sentences)

Stem-loop
             c     uc     uc         a  ---au    ---   cuu 
5' aguccaguuu agggc  cucuc  uuggcaggg gc     guga   agu   u
   |||||||||| |||||  |||||  ||||||||| ||     ||||   |||    
3' ucaggucaaa ucccg  gagag  aaccgucuc cg     uacu   ucg   u
             a     uu     ga         c  acuuu    cac   aug 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 28873121-28873226 [+]
intergenic
Database links

Mature sequence osa-miR399j

Accession MIMAT0000993
Sequence

76 - 

ugccaaaggagaguugcccua

 - 96

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence by similarity; MI0001020
Database links

References

1