Stem-loop sequence osa-MIR399i

AccessionMI0001061 (change log)
DescriptionOryza sativa miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

60 open access papers mention osa-MIR399i
(226 sentences)

Stem-loop
   guga    ca   u           c     u    -   a  -  ------------g    g 
5'     gaau  cag gcaguucuccu uggca ggag ggc ag ag             agcu a
       ||||  ||| ||||||||||| ||||| |||| ||| || ||             ||||  
3'     cuua  guc cgucgagagga accgu ccuu ccg uc uc             ucga a
   guga    cc   c           a     c    u   a  g  aaauaguagguaa    u 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 7650684-7650799 [+]
intergenic
Database links

Mature sequence osa-miR399i

Accession MIMAT0000992
Sequence

86 - 

ugccaaaggagagcugcccug

 - 106

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence by similarity; MI0001020

References

1