Stem-loop sequence osa-MIR399g

AccessionMI0001059 (change log)
DescriptionOryza sativa miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

58 open access papers mention osa-MIR399g
(226 sentences)

Stem-loop
   au   c     a      cua    a        --       -  ug  ua    uau   u 
5'   gug auugc gggcaa   cucc uuggcaga  gggaugg au  ga  ugga   ggc g
     ||| ||||| ||||||   |||| ||||||||  ||||||| ||  ||  ||||   |||  
3'   cac uagcg cccguu   gagg aaccgucu  cccuacc ua  uu  accu   ucg a
   cu   u     a      -ua    a        au       c  gu  --    ---   u 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 7675284-7675402 [+]
intergenic
Database links

Mature sequence osa-miR399g

Accession MIMAT0000990
Sequence

89 - 

ugccaaaggagauuugcccag

 - 109

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence by similarity; MI0001025

References

1