Stem-loop sequence osa-MIR399e

Accession

MI0001057

Description

Oryza sativa miR399e stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

aca      a c   ug       c         uuc    c  ca  --       ug 
   ugcauu c ggg  agucuuc uuggcagug   gaau gg  gu  accgguc  c
   |||||| | |||  ||||||| |||||||||   |||| ||  ||  |||||||  a
   acguaa g ccc  uuagagg aaccgucgc   cuug cc  ua  uggcuag  a
uca      c a   gu       a         -ca    a  ac  ac       ug 

Deep sequencing

158 reads, 4 experiments

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr1: 30477612-30477729 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR399e

• osa-MIR399a: Chr1: 30478636-30478784 [+]
• osa-MIR399e: Chr1: 30477612-30477729 [-]

Mature sequence osa-miR399e

• Accession: MIMAT0000988
• Sequence: 88 - ugccaaaggagauuugcccag - 108
• Deep sequencing: 139 reads, 4 experiments
• Evidence: by similarity; MI0001020

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).