Stem-loop sequence osa-MIR399d

AccessionMI0001056 (change log)
DescriptionOryza sativa miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

60 open access papers mention osa-MIR399d
(235 sentences)

Stem-loop
           a     -          c        gcauucua     uuuuguaauuguauaugcauccaagguauauacaguccggccauggugcuacauugcaaucauccauaugugauugcauuguguauauauauacau 
5' aagacagu guagg cagcucuccu uggcaggu        gguga                                                                                                g
   |||||||| ||||| |||||||||| ||||||||        |||||                                                                                                g
3' uucuguca cgucc guugagagga accguccg        ccacu                                                                                                u
           g     c          a        --gcaaaa     uaaguuagcgauguaccgcuagcuaguuucgaucaucgucgaccauauauguauguacguguauugguuggcuauauacuaccagauaguuuccgg 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 1561789-1562074 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR399d
osa-MIR439hChr6: 1553119-1553217 [-]
osa-MIR399dChr6: 1561789-1562074 [+]
Database links

Mature sequence osa-miR399d

Accession MIMAT0000987
Sequence

256 - 

ugccaaaggagaguugcccug

 - 276

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence by similarity; MI0001020
Database links

References

1