Stem-loop sequence osa-MIR399c

AccessionMI0001055 (change log)
DescriptionOryza sativa miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

58 open access papers mention osa-MIR399c
(227 sentences)

Stem-loop
   c  c    ua          u               cgga   aa   au c   g 
5'  gg gaau  cagggcgguu cuccuuuggcacgua    ggc  ggc  g ggu a
    || ||||  |||||||||| |||||||||||||||    |||  |||  | ||| a
3'  cc cuua  gucccguuaa gaggaaaccgugcgu    ccg  ucg  c cua a
   a  a    gc          -               ---a   -a   au u   a 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 26305938-26306047 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR399c
osa-MIR399kChr5: 26311253-26311358 [+]
osa-MIR399hChr5: 26307936-26308034 [+]
osa-MIR399cChr5: 26305938-26306047 [-]
Database links

Mature sequence osa-miR399c

Accession MIMAT0000986
Sequence

80 - 

ugccaaaggagaauugcccug

 - 100

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence by similarity; MI0001020
Database links

References

1