Stem-loop sequence osa-MIR399b

AccessionMI0001054 (change log)
DescriptionOryza sativa miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

59 open access papers mention osa-MIR399b
(228 sentences)

Stem-loop
   guga    ca   u           c          -  aga gc  aa 
5'     gaau  cag gcgauucuccu uggcauggca ug   g  cu  a
       ||||  ||| ||||||||||| |||||||||| ||   |  ||  a
3'     cuua  guc cguuaagagga accgugccgu ac   c  ga  a
   aaga    cc   c           a          c  --g -a  ga 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 7664026-7664122 [-]
intergenic
Database links

Mature sequence osa-miR399b

Accession MIMAT0000985
Sequence

67 - 

ugccaaaggagaauugcccug

 - 87

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence by similarity; MI0001020
Database links

References

1