Stem-loop sequence osa-MIR399b

Accession

MI0001054

Description

Oryza sativa miR399b stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

guga    ca   u           c          -  aga gc  aa 
    gaau  cag gcgauucuccu uggcauggca ug   g  cu  a
    ||||  ||| ||||||||||| |||||||||| ||   |  ||  a
    cuua  guc cguuaagagga accgugccgu ac   c  ga  a
aaga    cc   c           a          c  --g -a  ga 

Deep sequencing

193 reads, 4 experiments

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr2: 7664026-7664122 [-]
• Overlapping transcripts:

  intergenic

Mature sequence osa-miR399b

• Accession: MIMAT0000985
• Sequence: 67 - ugccaaaggagaauugcccug - 87
• Deep sequencing: 145 reads, 4 experiments
• Evidence: by similarity; MI0001020

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).