Stem-loop sequence osa-MIR399a

AccessionMI0001053 (change log)
DescriptionOryza sativa miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

60 open access papers mention osa-MIR399a
(242 sentences)

Stem-loop
   cugu    ua           a          aagggcaagcaguagaaaccaugcgugcuugcuagagcugg 
5'     gaau  cagggcaguuc ccuuuggcac                                         a
       ||||  ||||||||||| ||||||||||                                         a
3'     uuua  gucccguuaag ggaaaccgug                                         a
   cugu    gc           a          cucuagacacuagggacuugguacguuacgauggucguagu 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 30478636-30478784 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR399a
osa-MIR399eChr1: 30477612-30477729 [-]
osa-MIR399aChr1: 30478636-30478784 [+]
Database links

Mature sequence osa-miR399a

Accession MIMAT0000984
Sequence

119 - 

ugccaaaggagaauugcccug

 - 139

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence by similarity; MI0001020
Database links

References

1