Stem-loop sequence osa-MIR398b

AccessionMI0001052 (change log)
DescriptionOryza sativa miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

39 open access papers mention osa-MIR398b
(143 sentences)

Stem-loop
           ua         g              -u   g  g 
5' ggaguucc  caggggcga cugggaacacacgg  gau ag c
   ||||||||  ||||||||| ||||||||||||||  ||| || g
3' ucucaggg  guccccgcu gacucuugugugcu  cug uc g
           cc         g              uu   g  u 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 14598617-14598704 [-]
intergenic
Database links

Mature sequence osa-miR398b

Accession MIMAT0000983
Sequence

58 - 

uguguucucaggucgccccug

 - 78

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence by similarity; MI0001017
Database links

References

1