Stem-loop sequence osa-MIR398a

AccessionMI0001051 (change log)
DescriptionOryza sativa miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

37 open access papers mention osa-MIR398a
(104 sentences)

Stem-loop
   gcu           a   gua            g   caauacaauguauggugagc 
5'    gaacccagagg gug   cugagaacacag ugc                    u
      ||||||||||| |||   |||||||||||| |||                     
3'    uuuggguuucc cac   gacucuuguguc aug                    a
   uuc           c   -ug            a   ucuuaaugagguaauauguc 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR398 family of miRNAs, which are predicted to target mRNAs coding for copper superoxide dismutases and cytochrome C oxidase subunit V [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 9216250-9216364 [-]
intergenic
Database links

Mature sequence osa-miR398a

Accession MIMAT0000982
Sequence

85 - 

uguguucucaggucaccccuu

 - 105

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence by similarity; MI0001017

References

1