Stem-loop sequence osa-MIR397b

AccessionMI0001050 (change log)
DescriptionOryza sativa miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

39 open access papers mention osa-MIR397b
(199 sentences)

Stem-loop
     g      auu    a      c    a       gcc    ggcuaaauuaauuag 
5' ag gaaggc   auug gugcag guug ugaaccu   ggcc               c
   || ||||||   |||| |||||| |||| |||||||   ||||                
3' uc uuuccg   uaac cacguc cgac acuugga   ucgg               a
     g      cac    c      a    c       aac    ucaaagucugaaaga 
Get sequence
Deep sequencing
545 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR397 family of miRNAs, which are predicted to target mRNAs coding for laccases and beta-6 tubulin [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 3280781-3280898 [-]
intergenic
Database links

Mature sequence osa-miR397b

Accession MIMAT0000981
Sequence

11 - 

uuauugagugcagcguugaug

 - 31

Get sequence
Deep sequencing530 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).