Stem-loop sequence osa-MIR396c

AccessionMI0001048 (change log)
DescriptionOryza sativa miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

57 open access papers mention osa-MIR396c
(157 sentences)

Stem-loop
   u     gc                   a     -     --g    a   -----a     auu    ga  gau 
5'  gccau  cuuuccacagcuuucuuga cuucu cuugu   ccuc cuc      cuuuc   acug  ga   a
    |||||  ||||||||||||||||||| ||||| |||||   |||| |||      |||||   ||||  ||    
3'  cggua  gaagggugucgaaagaacu ggaga gaacg   ggag ggg      gaagg   ugac  cu   u
   a     aa                   g     a     uga    a   auauuc     ---    ua  acg 
Get sequence
Deep sequencing
425 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 34287873-34288013 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR396c
osa-MIR396cChr2: 34287873-34288013 [-]
osa-MIR396aChr2: 34280384-34280537 [+]
Database links

Mature sequence osa-miR396c-5p

Accession MIMAT0000979
Previous IDsosa-miR396c
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Deep sequencing144 reads, 2 experiments
Evidence by similarity; MI0001014
Database links

Mature sequence osa-miR396c-3p

Accession MIMAT0022865
Sequence

113 - 

ggucaagaaagcugugggaag

 - 133

Get sequence
Deep sequencing280 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).