Stem-loop sequence osa-MIR396b

AccessionMI0001047 (change log)
DescriptionOryza sativa miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

56 open access papers mention osa-MIR396b
(143 sentences)

Stem-loop
            c            c           -   ---    ag     a    cc 
5' cuuuguggu uuccacagcuuu uugaacugcau cuu   ugag  agauu gcau  c
   ||||||||| |||||||||||| ||||||||||| |||   ||||  ||||| ||||   
3' gagacauua agggugucgaaa aacuugacgug gag   guuc  uuuag ugug  u
            a            u           u   cac    gu     g    ua 
Get sequence
Deep sequencing
159 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 3669649-3669764 [+]
intergenic
Database links

Mature sequence osa-miR396b-5p

Accession MIMAT0000978
Previous IDsosa-miR396b
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Deep sequencing144 reads, 2 experiments
Evidence by similarity; MI0001013
Database links

Mature sequence osa-miR396b-3p

Accession MIMAT0022864
Sequence

88 - 

guucaauaaagcugugggaa

 - 107

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).