|
miRBase |
|
Stem-loop sequence osa-MIR396a |
||||||
| Accession | MI0001046 | |||||
| Description | Oryza sativa miR396a stem-loop | |||||
| Gene family | MIPF0000047; MIR396 | |||||
| Stem-loop |
ug c c acgcaugaugaauaaucccuuugguuaauugugaucuggucucu cuuug au uuccacagcuuu uugaacugc g ||||| || |||||||||||| ||||||||| gagac ua agggugucgaaa aacuugacg a gu a u agagagacuacgguuacguuggcuagcucagauugaugcuagag |
|||||
| Deep sequencing |
| |||||
| Comments |
This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence osa-miR396a-5p |
|
| Accession | MIMAT0000977 |
| Previous IDs | osa-miR396a |
| Sequence |
11 - uuccacagcuuucuugaacug - 31 |
| Deep sequencing | 1006 reads, 4 experiments |
| Evidence | by similarity; MI0001013 |
Mature sequence osa-miR396a-3p |
|
| Accession | MIMAT0022863 |
| Sequence |
126 - guucaauaaagcugugggaa - 145 |
| Deep sequencing | 162 reads, 3 experiments |
| Evidence | experimental; Solexa [2] |
References |
|
| 1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
| 2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|