Stem-loop sequence osa-MIR396a

AccessionMI0001046 (change log)
DescriptionOryza sativa miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

56 open access papers mention osa-MIR396a
(146 sentences)

Stem-loop
        ug  c            c         acgcaugaugaauaaucccuuugguuaauugugaucuggucucu 
5' cuuug  au uuccacagcuuu uugaacugc                                            g
   |||||  || |||||||||||| |||||||||                                             
3' gagac  ua agggugucgaaa aacuugacg                                            a
        gu  a            u         agagagacuacgguuacguuggcuagcucagauugaugcuagag 
Get sequence
Deep sequencing
160 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR396 family of miRNAs, which are predicted to target mRNAs coding for Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 34280384-34280537 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR396a
osa-MIR396aChr2: 34280384-34280537 [+]
osa-MIR396cChr2: 34287873-34288013 [-]
Database links

Mature sequence osa-miR396a-5p

Accession MIMAT0000977
Previous IDsosa-miR396a
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Deep sequencing144 reads, 2 experiments
Evidence by similarity; MI0001013
Database links

Mature sequence osa-miR396a-3p

Accession MIMAT0022863
Sequence

126 - 

guucaauaaagcugugggaa

 - 145

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).