Stem-loop sequence osa-MIR395u

AccessionMI0001044 (change log)
Previous IDsosa-MIR395f
DescriptionOryza sativa miR395u stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395u
(166 sentences)

Stem-loop
   ---      cca   a      u     aa     ga      auu 
5'    acacug   gga uucccu caagc  uucau  aacaau   u
      ||||||   ||| |||||| |||||  |||||  ||||||   u
3'    ugugac   ucu aagggg guuug  aagug  uuguug   g
   cgc      ---   a      -     cg     --      aga 
Get sequence
Deep sequencing
34 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 6606701-6606786 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395u
osa-MIR395tChr9: 6607353-6607495 [-]
osa-MIR395uChr9: 6606701-6606786 [-]
osa-MIR395vChr9: 6606575-6606643 [-]
osa-MIR395wChr9: 6606291-6606359 [-]
Database links

Mature sequence osa-miR395u

Accession MIMAT0000975
Previous IDsosa-miR395f
Sequence

56 - 

gugaagcguuugggggaaauc

 - 76

Get sequence
Deep sequencing33 reads, 2 experiments
Evidence by similarity; MI0001007

References

1
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).