Stem-loop sequence osa-MIR395f

AccessionMI0001043 (change log)
Previous IDsosa-MIR395a
DescriptionOryza sativa miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

40 open access papers mention osa-MIR395f
(173 sentences)

Stem-loop
   u     c         u   u  c           ---  au 
5'  uaucg ggguucccu caa ca uucacauggua   cu  u
    ||||| ||||||||| ||| || |||||||||||   ||   
3'  guagc cucaagggg guu gu aaguguaucau   ga  u
   u     u         -   u  u           ccg  ac 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31804774-31804855 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395f
osa-MIR395aChr4: 31805494-31805635 [-]
osa-MIR395bChr4: 31805334-31805419 [-]
osa-MIR395cChr4: 31805193-31805281 [-]
osa-MIR395dChr4: 31805055-31805142 [-]
osa-MIR395eChr4: 31804912-31804999 [-]
osa-MIR395fChr4: 31804774-31804855 [-]
osa-MIR395gChr4: 31804633-31804718 [-]
Database links

Mature sequence osa-miR395f

Accession MIMAT0000974
Previous IDsosa-miR395a
Sequence

55 - 

gugaauuguuugggggaacuc

 - 75

Get sequence
Deep sequencing32 reads, 2 experiments
Evidence by similarity; MI0001007

References

1
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).