Stem-loop sequence osa-MIR395t

AccessionMI0001038 (change log)
Previous IDsosa-MIR395n
DescriptionOryza sativa miR395t stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395t
(170 sentences)

Stem-loop
   uuau   -        c         c      ---gc  a         --a        -ug   -----    cc 
5'     cca cuggaguu uccucaaac acuuca     ag uagcuagcu   ggccucau   cau     ugca  a
       ||| |||||||| ||||||||| ||||||     || |||||||||   ||||||||   |||     ||||  c
3'     ggu ggccucaa agggguuug ugaagu     uc gucgauuga   ccggggua   gua     acgu  u
   -aac   u        -         -      gauau  -         aaa        cga   ucaau    ug 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 6607353-6607495 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395t
osa-MIR395tChr9: 6607353-6607495 [-]
osa-MIR395uChr9: 6606701-6606786 [-]
osa-MIR395vChr9: 6606575-6606643 [-]
osa-MIR395wChr9: 6606291-6606359 [-]
Database links

Mature sequence osa-miR395t

Accession MIMAT0000969
Previous IDsosa-miR395n
Sequence

113 - 

gugaaguguuuggggaaacuc

 - 133

Get sequence
Deep sequencing26 reads, 2 experiments
Evidence by similarity; MI0001007

References

1
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).