Stem-loop sequence osa-MIR395s

AccessionMI0001037 (change log)
Previous IDsosa-MIR395m
DescriptionOryza sativa miR395s stem-loop
Gene family MIPF0000016; MIR395
Literature search

40 open access papers mention osa-MIR395s
(167 sentences)

Stem-loop
   guau  c  u         u             --u    cua 
5'     ca cg gaguucccu caagcacuucacg   ggca   u
       || || ||||||||| |||||||||||||   ||||   u
3'     gu gc cucaagggg guuugugaagugu   ccgu   u
   ccuu  a  u         -             uau    aac 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 32622943-32623028 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395s
osa-MIR395mChr4: 32621993-32622112 [+]
osa-MIR395nChr4: 32622243-32622308 [+]
osa-MIR395oChr4: 32622381-32622449 [+]
osa-MIR395pChr4: 32622525-32622592 [+]
osa-MIR395qChr4: 32622668-32622735 [+]
osa-MIR395rChr4: 32622811-32622878 [+]
osa-MIR395sChr4: 32622943-32623028 [+]
osa-MIR395xChr4: 32623067-32623162 [+]
Database links

Mature sequence osa-miR395s

Accession MIMAT0000968
Previous IDsosa-miR395m
Sequence

56 - 

gugaaguguuugggggaacuc

 - 76

Get sequence
Deep sequencing39 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).