Stem-loop sequence osa-MIR395e

AccessionMI0001030 (change log)
DescriptionOryza sativa miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

39 open access papers mention osa-MIR395e
(168 sentences)

Stem-loop
     au               u   c         ----u   a  gu 
5' gu  uaucgagaguucccu caa cacuucacg     ggc cu  u
   ||  ||||||||||||||| ||| |||||||||     ||| ||   
3' ca  auagcucucaagggg guu gugaagugu     ccg ga  u
     cu               -   u         guuau   -  ac 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 31804912-31804999 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR395e
osa-MIR395aChr4: 31805494-31805635 [-]
osa-MIR395bChr4: 31805334-31805419 [-]
osa-MIR395cChr4: 31805193-31805281 [-]
osa-MIR395dChr4: 31805055-31805142 [-]
osa-MIR395eChr4: 31804912-31804999 [-]
osa-MIR395fChr4: 31804774-31804855 [-]
osa-MIR395gChr4: 31804633-31804718 [-]
Database links

Mature sequence osa-miR395e

Accession MIMAT0000961
Sequence

58 - 

gugaaguguuugggggaacuc

 - 78

Get sequence
Deep sequencing37 reads, 2 experiments
Evidence by similarity; MI0001007
Database links

References

1
2
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).