Stem-loop sequence osa-MIR394

AccessionMI0001027 (change log)
DescriptionOryza sativa miR394 stem-loop
Gene family MIPF0000100; MIR394
Literature search

26 open access papers mention osa-MIR394
(59 sentences)

Stem-loop
   ua   - g      -      u c           -uu     auccuca    ca 
5'   cug a aguucu uuggca u uguccaccucc   gucga       gaga  g
     ||| | |||||| |||||| | |||||||||||   |||||       ||||   
3'   gau u ucgagg aaccgu a acggguggagg   uaguu       cucu  a
   -g   g g      u      c u           uuc     gucuaua    aa 
Get sequence
Deep sequencing
125 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 27148154-27148263 [+]
intergenic
Database links

Mature sequence osa-miR394

Accession MIMAT0000958
Sequence

14 - 

uuggcauucuguccaccucc

 - 33

Get sequence
Deep sequencing123 reads, 2 experiments
Evidence by similarity; MI0001005
Database links

References

1