Stem-loop sequence osa-MIR393a

AccessionMI0001026 (change log)
Previous IDsosa-MIR393
DescriptionOryza sativa miR393 stem-loop
Gene family MIPF0000083; MIR393
Literature search

53 open access papers mention osa-MIR393a
(147 sentences)

Stem-loop
   u        a                u     u   uc   -  ---------  cu    u 
5'  ggggaagc uccaaagggaucgcau gaucc uca  gcu cu         cg  cgcu c
    |||||||| |||||||||||||||| ||||| |||  ||| ||         ||  |||| c
3'  cuccuucg agguuuuccuagcgua cuagg agu  cga ga         gc  gcgg a
   u        g                -     c   -u   c  acaucugcu  ug    u 
Get sequence
Deep sequencing
176 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence belongs to the miR393 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins and bHLH transcription factors [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 2309149-2309263 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR393a
osa-MIR5494Chr1: 2317278-2317395 [-]
osa-MIR393aChr1: 2309149-2309263 [-]
Database links

Mature sequence osa-miR393a

Accession MIMAT0000957
Previous IDsosa-miR393
Sequence

11 - 

uccaaagggaucgcauugauc

 - 31

Get sequence
Deep sequencing176 reads, 2 experiments
Evidence by similarity; MI0001003
Database links

References

1